ID: 1192175605_1192175613

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1192175605 1192175613
Species Human (GRCh38) Human (GRCh38)
Location X:68883172-68883194 X:68883208-68883230
Sequence CCGACCTTTGGGAGGGGCTGAGG CTGCTGGTTCAGATGTGTGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!