ID: 1192191331_1192191336

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1192191331 1192191336
Species Human (GRCh38) Human (GRCh38)
Location X:68993105-68993127 X:68993130-68993152
Sequence CCTGTCATGTAGGACTTACAGGA TCCTGGGTAAAAGGAGCAGTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!