ID: 1192264934_1192264942

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1192264934 1192264942
Species Human (GRCh38) Human (GRCh38)
Location X:69531512-69531534 X:69531547-69531569
Sequence CCTTTAGTGCCAGCAGGGCCTGT GATGCTAGTGAGTGAATGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 164} {0: 1, 1: 0, 2: 2, 3: 8, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!