ID: 1192274742_1192274748

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1192274742 1192274748
Species Human (GRCh38) Human (GRCh38)
Location X:69616899-69616921 X:69616927-69616949
Sequence CCCTGGGGACCCCTTGACTTGGA TCGCGCGCGCCCGCGGCCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 165} {0: 1, 1: 0, 2: 4, 3: 30, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!