ID: 1192274746_1192274748

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1192274746 1192274748
Species Human (GRCh38) Human (GRCh38)
Location X:69616910-69616932 X:69616927-69616949
Sequence CCTTGACTTGGAAAGTCTCGCGC TCGCGCGCGCCCGCGGCCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 42} {0: 1, 1: 0, 2: 4, 3: 30, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!