ID: 1192351826_1192351832

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1192351826 1192351832
Species Human (GRCh38) Human (GRCh38)
Location X:70362260-70362282 X:70362293-70362315
Sequence CCACATCCAGAGATGTGTGCACC AACTCAGCTCTTTCTCCGTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 145} {0: 1, 1: 0, 2: 2, 3: 10, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!