ID: 1192369775_1192369787

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1192369775 1192369787
Species Human (GRCh38) Human (GRCh38)
Location X:70503838-70503860 X:70503875-70503897
Sequence CCCCCCACCCCACTGTGCTCCTT CTCCCTCGCCTCCATACTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 75, 4: 665} {0: 1, 1: 0, 2: 0, 3: 10, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!