ID: 1192429712_1192429720

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1192429712 1192429720
Species Human (GRCh38) Human (GRCh38)
Location X:71103655-71103677 X:71103688-71103710
Sequence CCGGGGAGGTGGTGGAGTGTGGG CACCTAACCCCTGCAGGAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 62, 4: 544} {0: 1, 1: 0, 2: 1, 3: 9, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!