ID: 1192433331_1192433332

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1192433331 1192433332
Species Human (GRCh38) Human (GRCh38)
Location X:71127070-71127092 X:71127085-71127107
Sequence CCTGCGGCACTATCATGCCTGCC TGCCTGCCTCATCCTCAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 85} {0: 1, 1: 0, 2: 1, 3: 35, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!