ID: 1192440410_1192440416

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1192440410 1192440416
Species Human (GRCh38) Human (GRCh38)
Location X:71169806-71169828 X:71169833-71169855
Sequence CCCGGAGTTGGGAGCTGCTCCAG GGAGCTGGCAGCATTACAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 303} {0: 1, 1: 0, 2: 0, 3: 7, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!