ID: 1192493638_1192493648

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1192493638 1192493648
Species Human (GRCh38) Human (GRCh38)
Location X:71598370-71598392 X:71598401-71598423
Sequence CCCTCTTCCTCTCTTCCCCGCTC GGAATGACGAGGAAGAGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 21, 3: 250, 4: 2061} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!