ID: 1192509528_1192509534

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1192509528 1192509534
Species Human (GRCh38) Human (GRCh38)
Location X:71713674-71713696 X:71713715-71713737
Sequence CCTGGCTACTGAAGCTAAGGAGG TAACTAAGGTTCAAAGGTGAGGG
Strand - +
Off-target summary No data {0: 2, 1: 3, 2: 1, 3: 190, 4: 7014}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!