ID: 1192509706_1192509713

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1192509706 1192509713
Species Human (GRCh38) Human (GRCh38)
Location X:71714581-71714603 X:71714600-71714622
Sequence CCAGGGCCAGCCCACAGCCCTCC CTCCTAAGGTACCATGATTGTGG
Strand - +
Off-target summary {0: 6, 1: 1, 2: 8, 3: 82, 4: 826} {0: 3, 1: 0, 2: 0, 3: 10, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!