ID: 1192510364_1192510367

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1192510364 1192510367
Species Human (GRCh38) Human (GRCh38)
Location X:71717568-71717590 X:71717581-71717603
Sequence CCTTTCGCAGAGGGCTGCTGGGG GCTGCTGGGGATCCACGCGGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 14, 4: 197} {0: 2, 1: 0, 2: 0, 3: 7, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!