ID: 1192584529_1192584538

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1192584529 1192584538
Species Human (GRCh38) Human (GRCh38)
Location X:72308727-72308749 X:72308757-72308779
Sequence CCAGATTGTGGGCCCTGCCTAGT TGATAAAAGGCGGGATCTGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 115} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!