ID: 1192612603_1192612606

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1192612603 1192612606
Species Human (GRCh38) Human (GRCh38)
Location X:72582484-72582506 X:72582513-72582535
Sequence CCAGCATGGTGAGGACAAGGATG ACCAGCAGCTGACGGTACTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 168} {0: 1, 1: 1, 2: 0, 3: 10, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!