ID: 1192634396_1192634401

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1192634396 1192634401
Species Human (GRCh38) Human (GRCh38)
Location X:72804114-72804136 X:72804166-72804188
Sequence CCATCTTCTGTAGGACACCAGCA GCAGTCTGTAGAATTACCTCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 28, 4: 316} {0: 2, 1: 0, 2: 0, 3: 5, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!