ID: 1192642405_1192642415

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1192642405 1192642415
Species Human (GRCh38) Human (GRCh38)
Location X:72873519-72873541 X:72873553-72873575
Sequence CCCTGTATTCTCCTTTCAGGGAG GTGGGTTGCAAGGCTGGTGCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 23, 4: 188} {0: 2, 1: 0, 2: 1, 3: 26, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!