ID: 1192665007_1192665021

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1192665007 1192665021
Species Human (GRCh38) Human (GRCh38)
Location X:73079542-73079564 X:73079594-73079616
Sequence CCGCAGCCTCCGCTGCGGCGGCG CACCACCGTTGCCACCCGGGCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 23, 4: 406} {0: 2, 1: 0, 2: 0, 3: 7, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!