ID: 1192682075_1192682081

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1192682075 1192682081
Species Human (GRCh38) Human (GRCh38)
Location X:73262809-73262831 X:73262849-73262871
Sequence CCCTGAATCAACTAGAAAGGTGA CCCACATCCAAATTTATCAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 13, 2: 26, 3: 44, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!