ID: 1192694268_1192694270

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1192694268 1192694270
Species Human (GRCh38) Human (GRCh38)
Location X:73398337-73398359 X:73398354-73398376
Sequence CCATTACTTTGTACTCTGGACCT GGACCTTCATGGTCACACTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 189} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!