ID: 1192705538_1192705547

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1192705538 1192705547
Species Human (GRCh38) Human (GRCh38)
Location X:73526067-73526089 X:73526099-73526121
Sequence CCTGGCTTCAGGGATCCTACAGG GAGGCTGCCGCTGCTGCCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 292} {0: 1, 1: 1, 2: 9, 3: 88, 4: 696}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!