ID: 1192727777_1192727784

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1192727777 1192727784
Species Human (GRCh38) Human (GRCh38)
Location X:73769933-73769955 X:73769969-73769991
Sequence CCGAAGATGTAGAGCTGGCCAAC TGAACATGGTGAGGCTCAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 140} {0: 1, 1: 2, 2: 6, 3: 5, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!