ID: 1192733627_1192733636

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1192733627 1192733636
Species Human (GRCh38) Human (GRCh38)
Location X:73826935-73826957 X:73826978-73827000
Sequence CCAACTCAGGCCTTCGGTCCAAT TTGGCTCTTGAGGCTTTTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 68} {0: 1, 1: 0, 2: 0, 3: 37, 4: 381}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!