ID: 1192733807_1192733812

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1192733807 1192733812
Species Human (GRCh38) Human (GRCh38)
Location X:73829081-73829103 X:73829104-73829126
Sequence CCTCAAGTGCTAGAGTGCCAGGC ATGTTGATCTTCAGGTGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 69, 4: 2312} {0: 1, 1: 0, 2: 1, 3: 17, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!