ID: 1192742552_1192742553

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1192742552 1192742553
Species Human (GRCh38) Human (GRCh38)
Location X:73907268-73907290 X:73907291-73907313
Sequence CCATGGTGTATATGTGCATTTTC TTTATCCAATCTACCATTGATGG
Strand - +
Off-target summary {0: 4, 1: 77, 2: 138, 3: 281, 4: 1623} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!