ID: 1192764224_1192764229

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1192764224 1192764229
Species Human (GRCh38) Human (GRCh38)
Location X:74125926-74125948 X:74125959-74125981
Sequence CCACATGGATTAGGGAGATACAA CAGGTTTGGTGCTGGGTATAAGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 0, 3: 22, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!