ID: 1192815848_1192815852

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1192815848 1192815852
Species Human (GRCh38) Human (GRCh38)
Location X:74591240-74591262 X:74591275-74591297
Sequence CCTATAACGTGGCTTTTAAAATA CTGGAACAAAAACTGGAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 33, 4: 245} {0: 2, 1: 1, 2: 2, 3: 37, 4: 497}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!