ID: 1192818041_1192818053

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1192818041 1192818053
Species Human (GRCh38) Human (GRCh38)
Location X:74614659-74614681 X:74614698-74614720
Sequence CCGCAGCCCCACTCCCAGCCTAT ATTCCTCGAAAAGGCTCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 94, 4: 940} {0: 1, 1: 0, 2: 0, 3: 1, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!