ID: 1192862209_1192862211

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1192862209 1192862211
Species Human (GRCh38) Human (GRCh38)
Location X:75086967-75086989 X:75086980-75087002
Sequence CCTGGAAGTTGCTTTATATGGCT TTATATGGCTTAAAAGGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 22, 4: 182} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!