ID: 1192894310_1192894313

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1192894310 1192894313
Species Human (GRCh38) Human (GRCh38)
Location X:75424601-75424623 X:75424638-75424660
Sequence CCTCTGATACACATTAATATGTT ATATTCAGTCTTACCTAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 231} {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!