ID: 1192896547_1192896553

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1192896547 1192896553
Species Human (GRCh38) Human (GRCh38)
Location X:75448293-75448315 X:75448319-75448341
Sequence CCAGCTGAGGTGCTTGCTAAAGG AGGGAGTACAGAATGGATGGTGG
Strand - +
Off-target summary {0: 8, 1: 240, 2: 287, 3: 188, 4: 266} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!