ID: 1192931569_1192931574

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1192931569 1192931574
Species Human (GRCh38) Human (GRCh38)
Location X:75811781-75811803 X:75811817-75811839
Sequence CCATCATAATTTTAAGCTTCCTG CAGGCTTCCTGTACAGCTTGTGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 131, 3: 1202, 4: 4998} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!