ID: 1192965466_1192965470

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1192965466 1192965470
Species Human (GRCh38) Human (GRCh38)
Location X:76172725-76172747 X:76172751-76172773
Sequence CCTGCACTCTGCGCCCTAGCACC CATTTTCGTGAATCACTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 126} {0: 1, 1: 0, 2: 2, 3: 8, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!