ID: 1193031893_1193031902

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1193031893 1193031902
Species Human (GRCh38) Human (GRCh38)
Location X:76907500-76907522 X:76907535-76907557
Sequence CCCATTCTCCTGGATTAGGAGTT CCCTTGCCAGAAAGAGAAATTGG
Strand - +
Off-target summary {0: 4, 1: 16, 2: 40, 3: 64, 4: 189} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!