ID: 1193040540_1193040550

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1193040540 1193040550
Species Human (GRCh38) Human (GRCh38)
Location X:76999266-76999288 X:76999312-76999334
Sequence CCACCCTACTTCTGCTTACCCTG CCAGTTCCAATGAGATGAACCGG
Strand - +
Off-target summary No data {0: 12, 1: 168, 2: 425, 3: 391, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!