ID: 1193053487_1193053489

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1193053487 1193053489
Species Human (GRCh38) Human (GRCh38)
Location X:77125736-77125758 X:77125763-77125785
Sequence CCTGCCATCTTCTGCAGAAAACT TCCTTTTGAGAGACAGCTCTTGG
Strand - +
Off-target summary No data {0: 181, 1: 197, 2: 163, 3: 130, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!