ID: 1193084444_1193084447

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1193084444 1193084447
Species Human (GRCh38) Human (GRCh38)
Location X:77436811-77436833 X:77436851-77436873
Sequence CCACAATCCCTTGGGTAAACTAT CTTTAAAAGCAGTTGCTTTATGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 38, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!