ID: 1193124555_1193124567

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1193124555 1193124567
Species Human (GRCh38) Human (GRCh38)
Location X:77857409-77857431 X:77857457-77857479
Sequence CCCCGCACCTGTAACTCATATGT GCAGGAAAGTTGATGAAAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69} {0: 1, 1: 0, 2: 1, 3: 31, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!