ID: 1193149900_1193149907

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1193149900 1193149907
Species Human (GRCh38) Human (GRCh38)
Location X:78114063-78114085 X:78114100-78114122
Sequence CCTGTGCCAACCCAGCTGCTGGG GGAGAACCTCCGCTTTCATGTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 4, 3: 33, 4: 385} {0: 2, 1: 2, 2: 0, 3: 5, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!