ID: 1193209562_1193209563

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1193209562 1193209563
Species Human (GRCh38) Human (GRCh38)
Location X:78789972-78789994 X:78790014-78790036
Sequence CCAACTAGCATCATGATGTCAGA ATATTAGTCTTAAATGTAAATGG
Strand - +
Off-target summary {0: 3, 1: 4, 2: 52, 3: 522, 4: 1901} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!