ID: 1193237029_1193237033

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1193237029 1193237033
Species Human (GRCh38) Human (GRCh38)
Location X:79119963-79119985 X:79119992-79120014
Sequence CCTTGTTTGATTTTGGTATCAAG CCGATTTCATAGAATGAGTTGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 64, 3: 334, 4: 867} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!