ID: 1193237948_1193237956

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1193237948 1193237956
Species Human (GRCh38) Human (GRCh38)
Location X:79131650-79131672 X:79131696-79131718
Sequence CCTTGCACCCTCTGCCTCTAAAA AGGGATGCAGTCTGGAGTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 450} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!