ID: 1193286574_1193286580

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1193286574 1193286580
Species Human (GRCh38) Human (GRCh38)
Location X:79721895-79721917 X:79721930-79721952
Sequence CCTCTTGACCACAGTGGCTCTAC TTCTCTCAGCTCACCCTAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 144} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!