ID: 1193297777_1193297782

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1193297777 1193297782
Species Human (GRCh38) Human (GRCh38)
Location X:79852642-79852664 X:79852681-79852703
Sequence CCTGCCATCATCTGCACATAACT ACAGTTCTTGGCCTGTTACTGGG
Strand - +
Off-target summary No data {0: 8, 1: 192, 2: 200, 3: 144, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!