ID: 1193311890_1193311895

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1193311890 1193311895
Species Human (GRCh38) Human (GRCh38)
Location X:80020388-80020410 X:80020422-80020444
Sequence CCCCCCACTTTAATGGGTGCGAA GCTCAGATCACATGCAGATGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 23, 4: 460}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!