ID: 1193347218_1193347220

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1193347218 1193347220
Species Human (GRCh38) Human (GRCh38)
Location X:80417943-80417965 X:80417971-80417993
Sequence CCAATCAGGTGTAGACTTGGTCG CATAATCCTGTATTTCTTGGAGG
Strand - +
Off-target summary No data {0: 2, 1: 58, 2: 547, 3: 6927, 4: 3559}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!