ID: 1193428374_1193428377

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1193428374 1193428377
Species Human (GRCh38) Human (GRCh38)
Location X:81369089-81369111 X:81369108-81369130
Sequence CCTGTTGACCAAATTAAGTGATC GATCTGAGAGGACCACATTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 11, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!