ID: 1193446770_1193446774

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1193446770 1193446774
Species Human (GRCh38) Human (GRCh38)
Location X:81615397-81615419 X:81615413-81615435
Sequence CCCTTCTTCCTCAGGAACATCAA ACATCAATTATTGTTAGGTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 38, 2: 344, 3: 484, 4: 631}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!