ID: 1193473768_1193473774

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1193473768 1193473774
Species Human (GRCh38) Human (GRCh38)
Location X:81939262-81939284 X:81939308-81939330
Sequence CCTTGTTACAGCAGCCTAAGGTG GTTACTGGGAATTTTGTATTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!